Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05091

HP ID(1) HP05091
Gene ID(2) 5064
Gene Symbol finder PALM
Protein Name paralemmin
RefSeq NM_002579.2
Length of RefSeq (bp) 2890
Chromosome 19p13.3
Reference DDBJ accession
UniGene Hs.631841

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe34A10 pKA1U5 GCCGCGCCCGCCGCCGCCCGGACAATAAACAGCACCTTTTGCGCGGGGCGATGCCCGAGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl