Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05086

HP ID(1) HP05086
Gene ID(2) 22906
Gene Symbol finder TRAK1
Protein Name trafficking protein, kinesin binding 1
RefSeq NM_014965.3
Length of RefSeq (bp) 4630
Chromosome 3p25.3-p24.1
Reference DDBJ accession
UniGene Hs.535711

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe33F11 pKA1U5 GGAGAGGCCGCGCGTCGGCGCCCGCAACATTGCCCTTTTANCCGCAGGCAGCGCCNANAT
RBdS156O23 pGCAP10 GGCCCTTGACGCCCNCGCGCCTCAAGCGAGGCGTCCCCCAGAGTGGGGCCGCGCGCGGGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl