Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05065

HP ID(1) HP05065
Gene ID(2) 4863
Gene Symbol finder NPAT
Protein Name nuclear protein, ataxia-telangiectasia locus
RefSeq NM_002519.2
Length of RefSeq (bp) 5962
Chromosome 11q22-q23
Reference DDBJ accession
UniGene Hs.171061

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe32B12 pKA1U5 GAGTGCCGCCACTGGAACCAGGAGATGCGGCCCCCGNNCTGTCGCTGTGTTTGCTTNAAC
RBd69D02 pGCAP10 GGCCGTGAAGCGAAAGAGGCGGGACAAATTGCCGCGAGTTCAGTGCCGCCACTGGAACCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl