Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05042

HP ID(1) HP05042
Gene ID(2) 29798
Gene Symbol finder C2orf27
Protein Name chromosome 2 open reading frame 27
RefSeq NM_013310.3
Length of RefSeq (bp) 1222
Chromosome 2q21.1-q21.2
Reference DDBJ accession
UniGene Hs.655680

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe30E02 pKA1U5 GAGTTCCTGCGACGCCCCTGCAGCAGCAGCAGCGTGGTCAGAGCGAGCTTCTGAGCGGTG
ARe57H11 pKA1U5 GGTTCCTGCGACGCCCCTGCAGCAGCAGCAGCGCTGGTTCAGAGCGAGCTTCTGAGCGGT
ARi71B01 pGCAP10 GAGCGGCGTGGTCAGAGCGAGCTTCGGAGAAGCAGTGGTGGGTTCCATGTGATGGTGGAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl