Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05021

HP ID(1) HP05021
Gene ID(2) 64410
Gene Symbol finder KLHL25
Protein Name kelch-like 25 (Drosophila)
RefSeq NM_022480.3
Length of RefSeq (bp) 3683
Chromosome 15q25.3
Reference DDBJ accession
UniGene Hs.498371

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe28E01 pKA1U5 GGGGCTGCCGGGAGTGGTCTCTGAGGCGGCGGCGGCGGCGGGGATCGTCTCCGGCACTGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl