Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04995

HP ID(1) HP04995
Gene ID(2) 54972
Gene Symbol finder TMEM132A
Protein Name transmembrane protein 132A?
RefSeq NM_017870.3
Length of RefSeq (bp) 3520
Chromosome 11q12.2
Reference DDBJ accession
UniGene Hs.118552

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe26C06 pKA1U5 GCCCTCCCACCCCACTGCTCCCGCTCCATTGTCTGGGAATTGCAGCCGCGGGGCGGGCGG
ARe37A01 pKA1U5 GTCTGGGAATTGCAGCCGCGGGGCGGGCGGCGGCGGCGGCGGCGGCGGCCGGGACCCAGC
ARe47D08 pKA1U5 GTCTCCATTGTCTGGGAATTGCAGCCGCGGGGCGGNCGGCGGCGGCGGCGGCGGCGGCCG
ARi12E11 pGCAP10 AAAAGAGCCGCGGGGCGGGCGGCGGCGGCGGCGGCGGCGGCCGGGACCCAGCGGGCCAGG
ARi34G12 pGCAP10 GGTCTGGGAATTGCAGCCGCGGGGCGGGCGGCGGCGGCGGCGGCGGCGGCCGGGACCCAG
ARi65C02 pGCAP10 GATTGTCTGGGAATTGCAGCCGCGGGGCGGGCGGCGGCGGCGGCGGCGGCGGCCGGGACC
ARi67B06 pGCAP10 TTTCGCTCCCTCCCACCCCACTGCTCCCGCTCCATTGTCTGGGAATTGCAGCCGCGGGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl