Prev. | NRCD Clone B | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04994

HP ID(1) HP04994
Gene ID(2) 55717
Gene Symbol finder BRWD2
Protein Name bromodomain and WD repeat domain containing 2
RefSeq NM_018117.10
Length of RefSeq (bp) 4724
Chromosome 10q26
Reference DDBJ accession
UniGene Hs.144447

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe26B08 pKA1U5 GGCCTTCCTGGCTTGCGGGTCAGCNCCCANNTTCCTGGGCTGGCCGCCGGGTATGTNGCC
ARe37F04 pKA1U5 GGTCAGCGCCCAGGTCCTGGGCTGGCCGCCGGGCATGTTGCCCTACACAGNTGAACTTCA
RBd42F06 pGCAP10 GAGGTCCTGGGCTGGCCGCCGGGATGTTGCCCTACACAGTGAACTTCAAGGTGTCGGCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl