Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04980

HP ID(1) HP04980
Gene ID(2) 284114
Gene Symbol finder TMEM102
Protein Name transmembrane protein 102
RefSeq NM_178518.2
Length of RefSeq (bp) 1996
Chromosome 17p13.1
Reference DDBJ accession
UniGene Hs.655662

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe25C10 pKA1U5 GGAAGTAACCTGTTGAATCTATTTCTGCTCCCCACCCTTACTGCTTCCCATAAGGGGGAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl