Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04961

HP ID(1) HP04961
Gene ID(2) 64236
Gene Symbol finder PDLIM2
Protein Name PDZ and LIM domain 2 (mystique)
RefSeq NM_021630.4
Length of RefSeq (bp) 1857
Chromosome 8p21.2
Reference DDBJ accession
UniGene Hs.632034

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe23E10 pKA1U5 GAGAGTCGGGTAGACGGCAGCGGGAGCGGTGGCGTNTCCCCGCCTTCCCTCCCTCCCGGG
ARiS198N11 pGCAP10 GAGAGTCGGGTAGACGGCAGCGGGAGCGGTGGCGTCTCCCCGCCTTCCCTCCCTCCCGGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl