Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04938

HP ID(1) HP04938
Gene ID(2) 22974
Gene Symbol finder TPX2
Protein Name TPX2, microtubule-associated, homolog (Xenopus laevis)
RefSeq NM_012112.4
Length of RefSeq (bp) 3685
Chromosome 20q11.2
Reference DDBJ accession
UniGene Hs.719145

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe22B09 pKA1U5 GAGATCTGAGGCGAGGCTAGGTGAGCCGTGGGAAGAAAAGAGGGAGCAGCTAGGGCGCGG
ARe29H02 pKA1U5 GAGGTGAGCCGCTGGGTAAGAAAAGAGGGAGCAGCCTAGGGCGCGGGTCTCCCTCCTCCC
ARe73H08 pKA1U5 GGTTGTCAGATCTGAGGCGAGGCTAGGTGAGCCCCNTTAAAGAAAAGAGGGAGCAGCTAG
RBb65F12 pGCAP1 GGCTTCGTTGTCAGATCTGAGGCGAGGCTAGGTGAGCCGTGGGAAGAAAAGAGGGAGCAG
RBb65H07 pGCAP1 GGTTGTCAGATCTGAGGCGAGGCTAGGTGAGCCGTGGGAAGAAAAGAGGGAGCAGCTAGG
RBdS081D14 pGCAP10 GGTTGTCAGATCTGAGGCGAGGCTAGGTGAGCCGTGGGAAGAAAAGAGGGAGCAGCTAGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl