Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04937

HP ID(1) HP04937
Gene ID(2) 92667
Gene Symbol finder C20orf72
Protein Name chromosome 20 open reading frame 72
RefSeq NM_052865.2
Length of RefSeq (bp) 2142
Chromosome 20p11.23
Reference DDBJ accession
UniGene Hs.320823

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe22B06 pKA1U5 GGTCGCGAGAGGTTGTTCGCGCCTTGAGAGTTAAGCGAAGTGTGGTGGCTTCCAAGGAAT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl