Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04933

HP ID(1) HP04933
Gene ID(2) 122769
Gene Symbol finder PPIL5
Protein Name peptidylprolyl isomerase (cyclophilin)-like 5
RefSeq NM_152329.3
Length of RefSeq (bp) 1760
Chromosome 14q22.1
Reference DDBJ accession
UniGene Hs.710054

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe22A02 pKA1U5 GACCCGATGGCGGCGCCGGGTGGCGGGAAGGAGGAAGTTTCAAAGCCAGCTTGACCTGGT
RBd39E01 pGCAP10 GACCCCGATGGCGGCGCCGGGTGGCGGGAAGGAGGAAGTTTCAAAGCCAGCTTGACGTGG
RBd64H05 pGCAP10 GATGCTCCCGGCTGCTCCCTAGGCGAAAGCCCGCCTTGGGGGTTCCTGAACTCCCAGCCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl