Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04929

HP ID(1) HP04929
Gene ID(2)
Gene Symbol finder C11orf61 (upstream, opposite)
Protein Name CDNA clone IMAGE:4837134
RefSeq
Length of RefSeq (bp) 2900
Chromosome 11q24.2
Reference DDBJ accession BC036195.1
UniGene Hs.564177

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe21F07 pKA1U5 AB371432 GCTGCCCTCGGGCCTGGCTCGCCCGCGGGCGGATGGCTCCGGGTCTCTGCTGCTGAGGAT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl