Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04927

HP ID(1) HP04927
Gene ID(2) 23509
Gene Symbol finder POFUT1
Protein Name protein O-fucosyltransferase 1
RefSeq NM_015352.1
Length of RefSeq (bp) 5249
Chromosome 20q11
Reference DDBJ accession
UniGene Hs.472409

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe21E11 pKA1U5 GCCCTCCTTCCCTCCCCGACTGTGCGCCGCGGCTGGCTCGGGTTCCCGGGCCGACATGGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl