Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04925

HP ID(1) HP04925
Gene ID(2) 56851
Gene Symbol finder C15orf24
Protein Name chromosome 15 open reading frame 24
RefSeq NM_020154.2
Length of RefSeq (bp) 1075
Chromosome 15q14
Reference DDBJ accession
UniGene Hs.160565

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe21E07 pKA1U5 GGCTGTCATGGCGGCCGCTCTGTGGGGCTTCTTTCCCGATCCTGCTGCTGCTGCTGCTAT
ARe68A07 pKA1U5 GGGGGCTGCCGGTCTGAGTGCAGAGCTGCTGTCATGGCGGCCGCTCTGTGGGGCTTCTTT
ARiS023N16 pGCAP10 GGGTCTGAGTGCAGAGCTGCTGTCATGGCGGCCGCTCTGTGGGGCTTCTTTCCCGTCCTG
RBb67D01 pGCAP1 GATCCCGTTCGAGTGGATATCACTTCGAAAGGAAAAATGAGAGCAAGATATGTGAATTAC
RBdS075I04 pGCAP10 GGCAGAGCTGCTGTCATGGCGGCCGCTCTGTGGGGCTTCTTTCCCGTCCTGCTGCTGCTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl