Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04900

HP ID(1) HP04900
Gene ID(2) 84934
Gene Symbol finder C12orf52
Protein Name chromosome 12 open reading frame 52
RefSeq NM_032848.1
Length of RefSeq (bp) 1775
Chromosome 12q24.13
Reference DDBJ accession
UniGene Hs.524762

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe18F12 pKA1U5 GGGGTTTCTGGATTCGCGGGCCGTTCACACGNTACCNTGATGCCGGCTCCTCGGGTGAGT
ARe96F02 pKA1U5 GGGTTGCTGGGTGCTAAGTGCTGGGTTCTGGGTTTCTGGATTCGCGGGCCGTTCACACGT
RBd95G05 pGCAP10 GGTAGGTGCGGTGACCACGTGACCTCCGCTGAGCTTTCGCCAGTGCCTGCGGCCCTCGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl