Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04864

HP ID(1) HP04864
Gene ID(2) 88745
Gene Symbol finder C6orf153
Protein Name chromosome 6 open reading frame 153
RefSeq NM_033112.2
Length of RefSeq (bp) 1177
Chromosome 6p21.1
Reference DDBJ accession
UniGene Hs.309231

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe15H07 pKA1U5 GATTCGTCTTCCGAGCGCTACTGCCAGCTGATGCCGGGAGCTAACTACCGCGCCGGGGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl