Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04845

HP ID(1) HP04845
Gene ID(2) 10043
Gene Symbol finder TOM1
Protein Name target of myb1 (chicken)
RefSeq NM_005488.1
Length of RefSeq (bp) 2310
Chromosome 22q13.1
Reference DDBJ accession
UniGene Hs.474705

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe14F10 pKA1U5 GGCGTCACGTGACGGGTCGGTGGCGCTGGCGGTTGCTGTCAGCTGATTCCCGGGGTTGGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl