Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04838

HP ID(1) HP04838
Gene ID(2) 5829
Gene Symbol finder PXN
Protein Name paxillin
RefSeq NM_002859.2
Length of RefSeq (bp) 3691
Chromosome 12q24.31
Reference DDBJ accession
UniGene Hs.446336

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe14D04 pKA1U5 GTCCGGGACCTAGGCTCGCGGCGGAAAAGTTGCCNNTNATAGNACAAGCGGCCCCGGGAC
ARe99A07 pKA1U5 TTTCCTGGGGACTTACTCACCGAGTGAAAGCACCCCGCTGCGGATTAGATTACCTCTGCT
ARi69A05 pGCAP10 GCCGTTCCGGGCCGAGGCTCGCGGCGGAAAAGTTGCGGGGCATAGACGAGCGGCCCCGGG
ARiS013B19 pGCAP10 GGGGCNNGGGCGCGCGCGGCGGCGGCGCGTTCCGTTCCGGGCCGAGGCTCGCGGCGGAAA
ARiS122L16 pGCAP10 TGGGGCCGAGGCTCGCGGCGGAAAAGTTGCGGGGCATAGACGAGCGGCCCCGGGACGGGC
ARiS191E16 pGCAP10 GGCGGCGGGCGCGGGCGCGGGCGCGCGCGGCGGCGGCGCGTTCCGTTCCGGGCCGAGGCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl