Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04828

HP ID(1) HP04828
Gene ID(2) 10548
Gene Symbol finder TM9SF1
Protein Name transmembrane 9 superfamily member 1
RefSeq NM_006405.5
Length of RefSeq (bp) 2449
Chromosome 14q11.2
Reference DDBJ accession
UniGene Hs.91586

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe13E12 pKA1U5 GACCGCGCCGCTGTGGGAGAGACCCCAGCAGGAGCCCAAGGGCAGCTACGGGGGCGCGAA
ARe90C10 pKA1U5 GACCGCGCCGCTGTGGGAGAGACCCCAGCAGGAGCCCAAAGGCAGCTACGGGGGCGCGAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl