Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04812

HP ID(1) HP04812
Gene ID(2) 81831
Gene Symbol finder NETO2
Protein Name neuropilin (NRP) and tolloid (TLL)-like 2
RefSeq NM_018092.3
Length of RefSeq (bp) 3653
Chromosome 16q11
Reference DDBJ accession
UniGene Hs.444046

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe12D09 pKA1U5 GGCCACTTCAGTGGATCCCGCGCCGGGGCCGCGGGCGGAGCTGCCTGCCGGTCCCGCGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl