Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04803

HP ID(1) HP04803
Gene ID(2) 26517
Gene Symbol finder TIMM13
Protein Name translocase of inner mitochondrial membrane 13 homolog (yeast)
RefSeq NM_012458.2
Length of RefSeq (bp) 1977
Chromosome 19p13.3
Reference DDBJ accession
UniGene Hs.75056

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe12B01 pKA1U5 GCCGGTTGACTTTGCGGAGCCATGGTAGGGCGGCTTCGGCTCCGATTTCGGGGGCTCCGG
ARe25H02 pKA1U5 ATCCTGTGGCACGCGGCCTCGGTCCGGTTGACTTTGCGGAGCCATGGAGGGCGGCTTCGG
ARe59H02 pKA1U5 GGCCTCGGTCCGGTTGACTTTGCGGAGCCATGGAGGGCGGCTTCGGCTCCGATTTCGGGG
ARi33H11 pGCAP10 GAGTTACGAGTCGGCGCACGCGGCCTCGGTCCGGTTGACTTTGCGGAGCCATGGAGGGCG
ARi46B11 pGCAP10 GAGTTAGTTACGAGTCGGCGCACGCGGCCTCGGTCCGGTTGACTTTGCGGAGCCATGGAG
ARiS020A06 pGCAP10 GGTTGNTTCCTGAGGNCACTNCGNCGNNGGNAAATGNANNNNNGCGAGNCNTGNAGGGCN
RBb11A03 pKA1U5 GCCGGTTGACTTTGCGGAGCCATGGAGGGCGGCTTCGGCTCCGATTTCGGGGGCTCCGGC
RBb34D08 pGCAP1 GGACTTTGCGGAGCCATGGAGGGCGGCTTCGGCTCCGATTTCGGGGGCTCCGGCAGCGGG
RBb70B06 pGCAP1 GCCGGTTGACTTTGCGGAGCCATGGAGGGCGGCTTCGGCTCCGATTTCGGGGGCTCCGGC
RBd28A06 pGCAP10 GCCGGTTGACTTTGCGGAGCCATGGAGGGCGGCTTCGGCTCCGATTTCGGGGGCTCCGGC
RBd30B03 pGCAP10 GGGTCCGGTTGACTTTGCGGAGCCATGGAGGGCGGCTTCGGCTCCGATTTCGGGGGCTCC
RBd51H10 pGCAP10 GGACTTTGCGGAGCCATGGAGGGCGGCTTCGGCTCCGATTTCGGGGGCTCCGGCAGCGGG
RBd52A01 pGCAP10 GGACTTTGCGGAGCCATGGAGGGCGGCTTCTGCTCCGATTTCGGGGGCTCCGGCAGCGGG
RBd54B03 pGCAP10 AGTTAGTTACGAGTCGGCGCACGCGGCCTCGGTCCGGTTGACTTTGCGGAGCCATGGAGG
RBd72C09 pGCAP10 GAGTTAGTTACGAGTCGGCGCACGCGGCCTCGGTCCGGTTGACTTTGCGGAGCCATGGAG
RBdS014H11 pGCAP10 GAGTCGGCGCACGCGGCCTCGGTCCGGTTGACTTTGCGGAGCCATGGAGGGCGGCTTCGG
RBdS040E03 pGCAP10 TGAGTTACGAGTCGGCGCACGCGGCCTCGGTCCGGTTGACTTTGCGGAGCCATGGAGGGC
RBdS040M19 pGCAP10 GGAGTCGGCGCACGCGGCCTCGGTCCGGTTGACTTTGCGGAGCCATGGAGGGCGGCTTCG
RBdS187A07 pGCAP10 GACGAGTCGGCGCACGCGGCCTCGGTCCGGTTGACTTTGCGGAGCCATGGAGGGCGGCTT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl