Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04764

HP ID(1) HP04764
Gene ID(2) 27348
Gene Symbol finder TOR1B
Protein Name torsin family 1, member B (torsin B)
RefSeq NM_014506.1
Length of RefSeq (bp) 2774
Chromosome 9q34
Reference DDBJ accession
UniGene Hs.252682

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe09F01 pKA1U5 GAGTGGCTTCTGCGGGCTTCGAGGAGCGGGATGTTGCGGGCTGGGTGGCTCCGGGGCGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl