Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04729

HP ID(1) HP04729
Gene ID(2) 29107
Gene Symbol finder NXT1
Protein Name NTF2-like export factor 1
RefSeq NM_013248.2
Length of RefSeq (bp) 1176
Chromosome 20p11.21-12.3
Reference DDBJ accession
UniGene Hs.516933

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe06F11 pKA1U5 GGAGACCGGCTGGCCGCGCGCGGGAAGCCGCGGAACTGCGCCGGAAAGTCCCCCGGCTCT
RBd73G09 pGCAP10 GGGCTGGCCGCGCGCGGGAAGCCGCGGAACTGCGCCGGAAAGTCCCCCGGCTCTGGGGCC
RBdS156B19 pGCAP10 GGAGACCGGCTGGCCGCGCGCGGGAAGCCGCGGAACTGCGCCGGAAAGTCCCCCGGCTCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl