Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04722

HP ID(1) HP04722
Gene ID(2) 5129
Gene Symbol finder PCTK3
Protein Name PCTAIRE protein kinase 3
RefSeq NM_002596.2
Length of RefSeq (bp) 3157
Chromosome 1q31-q32
Reference DDBJ accession
UniGene Hs.445402

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe06A01 pKA1U5 GGTCAACTTGCTACATGTGAAAAACTCTGGCGGGGGCCGGGCATTTTCCTTCCTCCTCCT
RBdS132O23 pGCAP10 GACCTCCTCCTCGGCCAGCTCAGGTTGCAGCTTCTCTGGGGAACTGCTCACCTTTCCGGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl