Prev. | NRCD Clone Y | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04708

HP ID(1) HP04708
Gene ID(2) 91746
Gene Symbol finder YTHDC1
Protein Name YTH domain containing 1
RefSeq NM_133370.2
Length of RefSeq (bp) 6195
Chromosome 4q13.2
Reference DDBJ accession
UniGene Hs.175955

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe04E02 pKA1U5 GAGTCGCGTCTAAGCGGCGGCGGCGGTGGCAGCGGCGGAAACCGAAGGGGAGCCATGGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl