Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04702

HP ID(1) HP04702
Gene ID(2) 120379
Gene Symbol finder PIH1D2
Protein Name PIH1 domain containing 2
RefSeq NM_138789.3
Length of RefSeq (bp) 1252
Chromosome 11q23.1
Reference DDBJ accession
UniGene Hs.420662

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe04C03 pKA1U5 GAGGCGTCGCGGTTTGTCAAGGAACTGAGAGAAGAGGCTTAAGAAAATTATTCACCACTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl