Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04663

HP ID(1) HP04663
Gene ID(2) 27075
Gene Symbol finder TSPAN13
Protein Name tetraspanin 13
RefSeq NM_014399.3
Length of RefSeq (bp) 1912
Chromosome 7p21.1
Reference DDBJ accession
UniGene Hs.364544

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi35B12 pGCAP10 GGGGTCCGAGCCGCCGCGCGCGCGCCGCGCACTGCAGCCCCAGGCCCCGGCCCCCCACCC
ARiS008G07 pGCAP10 GGGGTCCGAGCCGCCGCCGCGCGCGCGCCGCGCACTGCAGCCCCAGGCCCCGGCCCCCCA
ARiS013M19 pGCAP10 GGGGTCCGAGCCGCCCCCGCGCGCGCGCCGCGCACTGCAGCCCCAGGCCCCGGCCCCCCA
ARiS122M19 pGCAP10 GGGGTCCGAGCCGCCGCGCGCGCGCCGCGCACTGCAGCCCCAGGCCCCGGCCCCCCACCC
RBdS104K18 pGCAP10 GGGGTCCGAGCCGCCGCCGCGCGCGCGCCGCGCACTGCAGCCCCAGGCCCCGGCCCCCCA
RBdS104P19 pGCAP10 GGCGGCCGCAGGTTCCAAAGCGGGTCCGAGCCGCCGCCGCGCGCGCGCCGCGCACTGCAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl