Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04624

HP ID(1) HP04624
Gene ID(2) 5358
Gene Symbol finder PLS3
Protein Name plastin 3 (T isoform)
RefSeq NM_005032.3
Length of RefSeq (bp) 3089
Chromosome Xq23
Reference DDBJ accession
UniGene Hs.496622

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe39A07 pKA1U5 GAGGAGGGGAGGTCATCTCTGGCTTTATAGCCACACCTGCAAANATTCCGAGGCTGCACA
ARi11C03 pGCAP10 GGGTGCAGAAGTTGTCTGAGTGGGTTGGTCGGCGGCAGTCGGGCCAGACCCAGGACTCTG
ARi39D01 pGCAP10 GGCAGAAGTTGTCTGAGTGGGTTGGTCGGCGGCAGTCGGGCCAGACCCAGGACTCTGCGA
ARi59H03 pGCAP10 GGCAGAAGTTGTCTGAGTGGGTTGGTCGGCGGCAGTCGGGCCAGACCCAGGACTCTGCGA
ARiS096L09 pGCAP10 GACACAGCTGCAAAGATTCCGAGGTGCANAAGTTGTCTGAGTGGGTTGGTCGGCGGCAGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl