Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04618

HP ID(1) HP04618
Gene ID(2) 119032
Gene Symbol finder C10orf32
Protein Name chromosome 10 open reading frame 32
RefSeq NM_144591.3
Length of RefSeq (bp) 1653
Chromosome 10q24.32
Reference DDBJ accession
UniGene Hs.34492

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe03G01 pKA1U5 ATCCTGGCCCGGCGACTCACCATCGTCAGTGCGCAACCGTTCGCTAACTGAAATGATGGC
ARi39F03 pGCAP10 GAGTGCGCAACCGTTCGCTAACTGAAATGATGGCGACTGGAACGCCAGAGTCTCAAGCGC
RBd17G12 pGCAP10 GGCCAGGCCTGGTGGCTCACTCCTGTAATCCCAGCACTTTGGGAGGCCGAGGTGGGCGGA
RBdS187I06 pGCAP10 GGAAATGATGGCGACTGGAACGCCAGAGTCTCAAGCGCGGTTCGGTCAGTCCGTGAAGGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl