Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04615

HP ID(1) HP04615
Gene ID(2) 149603
Gene Symbol finder RNF187
Protein Name ring finger protein 187
RefSeq NM_001010858.1
Length of RefSeq (bp) 2685
Chromosome 1q42.13
Reference DDBJ accession
UniGene Hs.356377

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb32C12 pGCAP1 GCGTCCCCGGCGTTGGCGTCTTCGTCCTGATTGCTGGTCTCCGNTTCGGTTCGCCGGCCG
RBd55B05 pGCAP10 TCGTCCTGTTGCTGGTCTCCGTCCGGTCGCCGGCCGTCTANNNNNNNNGCCCTCCCCAGC
RBd93D12 pGCAP10 GGCCCCGTGCGCGTCCCCGGCGTTGGCGTCTTCGTCCTGTTGCTGGTCTCCGTCCGGTCG
RBd95E11 pGCAP10 GGCCCCGTGCGCGTCCCCGGCGTTGGCGTCTTCGTCCTGTTGCTGGTCTCCGTCCGGTCG
RBdS110C21 pGCAP10 GGCGCTGCAGCTGCTGTGCCGCGCCGACGCCGGCCCGCTCTGCGCCGCCTGCCGTATGGC
RBdS110J09 pGCAP10 TCGTCCTGTTGCTGGTCTCCGTCCGGTCGCCGGCCGTCTAGGTCTCCGGCCCTCCCCAGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl