Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04613

HP ID(1) HP04613
Gene ID(2) 54952
Gene Symbol finder TRSPAP1
Protein Name tRNA selenocysteine associated protein 1
RefSeq NM_017846.4
Length of RefSeq (bp) 1884
Chromosome 1p35.3
Reference DDBJ accession
UniGene Hs.533626

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb45G03 pGCAP1 GCCCGCCCGCAGAGCCCCGCCCGCAAAGTCCCACCCCGGTGCGCGGGTATGGCGGCCAGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl