Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04611

HP ID(1) HP04611
Gene ID(2) 51528
Gene Symbol finder C14orf100
Protein Name chromosome 14 open reading frame 100
RefSeq NM_016475.3
Length of RefSeq (bp) 2377
Chromosome 14q23.1
Reference DDBJ accession
UniGene Hs.446850

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARf02C02 pKA1U5 GGCTGATCTAGTGCTTCTCGAAAAAAACCTTCAGGCGGCCCATGGCTGTCGATATTCAAC
RBdS070M23 pGCAP10 GAAACCCGGAAGCGAGGGAGGAACTTCGGAGCTGTCGCCCGGGTTACCGGGAGGCGGAGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl