Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04606

HP ID(1) HP04606
Gene ID(2)
Gene Symbol finder KIAA1529(exon 1, antisense)
Protein Name Homo sapiens cDNA FLJ25898 fis, clone CBR03893
RefSeq
Length of RefSeq (bp) 1595
Chromosome 9q22.33
Reference DDBJ accession AK098764.1
UniGene

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARa64F12 pKA1U5 GGGGTCCCAATCAGGTGCTGCTGGGAGGAGGCGCGTCAGCCAGGGGTGGAGGAAGCAGAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl