Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04605

HP ID(1) HP04605
Gene ID(2) 318
Gene Symbol finder NUDT2
Protein Name nudix (nucleoside diphosphate linked moiety X)-type motif 2
RefSeq NM_147173.1
Length of RefSeq (bp) 947
Chromosome 9p13
Reference DDBJ accession
UniGene Hs.493767

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS087K03 pGCAP10 GGTCCNAGGTCCNCCTCCTACCTCCTTCTGCTTCGGTGCGTTTGCTTCTGAGGATCTCCA
RBb72B12 pGCAP1 GGTACTTCAGTTTCCGTCCAAGGTCCGCCTCCTACCTCCTTCTGCTTCGGTGCGTTTGCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl