Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04587

HP ID(1) HP04587
Gene ID(2) 5891
Gene Symbol finder RAGE
Protein Name renal tumor antigen
RefSeq NM_014226.1
Length of RefSeq (bp) 1954
Chromosome 14q32
Reference DDBJ accession
UniGene Hs.104119

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe26C04 pKA1U5 GACACAGATAAAATGTGTCTCCTTCGTCTCTACTAGAGAGGAAAAAGAACTGGAATTGGA
ARe39G11 pKA1U5 TTTGACTGGTGCTGGAGTTTTGAGTCCACAGATAAAATGTGTCTCCTTCGTCTCTACTAG
ARi71G04 pGCAP10 GAGGAAAAAGAACTGGAATTGGAAGAACAGGGAGACTGAAGGGTAGCAAGAGAGGCTGGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl