Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04586

HP ID(1) HP04586
Gene ID(2) 51569
Gene Symbol finder UFM1
Protein Name ubiquitin-fold modifier 1
RefSeq NM_016617.2
Length of RefSeq (bp) 2618
Chromosome 13q13.3
Reference DDBJ accession
UniGene Hs.719178

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe84H09 pKA1U5 GAGAGGAAGTCGGTGCTACCCCCGCGGAGGTTGTCGTGTGTTCTGGATTCATTCCGGCAC
ARi19G06 pGCAP10 GAGCACACTAGAGGAAGTCGTGCTACCCCCGCGGAGTTGTCGTGTGTTCTGGATTCATTC
ARiS161D10 pGCAP10 GAGAGGAAGTCGTGCTACCCCCGCGGAGTTGTCGTGTGTTCTGGATTCATTCCGGCACCA
RBb27G10 pGCAP1 GGGGAGACGTGGACGTGAGTGGAGCGGGGCGGTCCCCAGCACACTAGAGGAAGTCGTGCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl