Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04583

HP ID(1) HP04583
Gene ID(2) 9373
Gene Symbol finder PLAA
Protein Name phospholipase A2-activating protein
RefSeq NM_001031689.2
Length of RefSeq (bp) 4954
Chromosome 9p21
Reference DDBJ accession
UniGene Hs.27182

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARa60G03 pKA1U5 GCCTTCCCAGCCGCCCTTCCGTACCGGCTCTCGGGCTCTTCCGGTCTCCGGCCGCCCCTT
RBd39H09 pGCAP10 GGTCACTCGGCCCGCTCGGCGCGCCCCTTCCCAGCCGCCCTTCCGTACCGGCTCTCGGGC
RBd60C01 pGCAP10 GGCTGTGTCACTCGGCCCGCTCGGCGCGCCCCTTCCCAGCCGCCCTTCCGTACCGGCTCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl