Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04564

HP ID(1) HP04564
Gene ID(2) 80213
Gene Symbol finder TM2D3
Protein Name TM2 domain containing 3
RefSeq NM_025141.3
Length of RefSeq (bp) 1343
Chromosome 15q26.3
Reference DDBJ accession
UniGene Hs.288912

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe31F01 pKA1U5 GAGGCGCTGGCAAGATGGCGGGAGGGGTGCGCCCGCTGAGGGGCCTCCGCGCCTTGTGTC
RBb43A07 pGCAP1

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl