Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04558

HP ID(1) HP04558
Gene ID(2) 79706
Gene Symbol finder PRKRIP1
Protein Name PRKR interacting protein 1 (IL11 inducible)
RefSeq NM_024653.3
Length of RefSeq (bp) 2181
Chromosome 7q22.1
Reference DDBJ accession
UniGene Hs.406395

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARa54H11 pKA1U5 TGGCCGCCGCTCGCTTGTGAAACTGGAAGGCTGCCATGGCTAGCCCAGCCGCCTCCTCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl