Prev. | NRCD Clone O | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04536

HP ID(1) HP04536
Gene ID(2) 5000
Gene Symbol finder ORC4L
Protein Name origin recognition complex, subunit 4-like (yeast)
RefSeq NM_002552.2
Length of RefSeq (bp) 2818
Chromosome 2q22-q23
Reference DDBJ accession
UniGene Hs.558364

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARa52D04 pKA1U5 GGTGTACGGTCCGCAGCGGCAGGTGAAGCCTAGCAGAGGACGCGGCCAGGCGATTCGGTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl