Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04534

HP ID(1) HP04534
Gene ID(2) 51535
Gene Symbol finder PPHLN1
Protein Name periphilin 1
RefSeq NM_016488.5
Length of RefSeq (bp) 3483
Chromosome 12q12
Reference DDBJ accession
UniGene Hs.444157

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS161J22 pGCAP10 GACCTGGGATAACGGCGGCGAGCGGACGGCTGCATTTACGGGGTCTCCCGGAGGGCCAGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl