Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04528

HP ID(1) HP04528
Gene ID(2) 9409
Gene Symbol finder PEX16
Protein Name peroxisomal biogenesis factor 16
RefSeq NM_057174.2
Length of RefSeq (bp) 1794
Chromosome 11p11.2
Reference DDBJ accession
UniGene Hs.100915

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARa51C02 pKA1U5 GAGGAAGCAGGGCGCCGCAGCCTGTCGTACGGGTCCTTCTGTGGGTCTGTCGGTGCCGAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl