Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04526

HP ID(1) HP04526
Gene ID(2) 112752
Gene Symbol finder C14orf179
Protein Name chromosome 14 open reading frame 179
RefSeq NM_052873.2
Length of RefSeq (bp) 865
Chromosome 14q24.3
Reference DDBJ accession
UniGene Hs.532626

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS161J04 pGCAP10 GGCGGAGATGGAGGATTTGCTCGACTTGGACGAGGAGCTTCGCTACAGCTTGGCTACCTC
ARiS161P05 pGCAP10 GGCGGAGATGGAGGATTTGCTCGACTTGGACGAGGAGCTTCGCTACAGCTTGGCTACCTC
RBd56A09 pGCAP10 GGGAGATGGAGGATTTGCTCGACTTGGACGAGGAGCTTCGCTACAGCTTGGCTACCTCCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl