Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04520

HP ID(1) HP04520
Gene ID(2) 116238
Gene Symbol finder TLCD1
Protein Name TLC domain containing 1
RefSeq NM_138463.2
Length of RefSeq (bp) 1098
Chromosome 17q11.2
Reference DDBJ accession
UniGene Hs.499952

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARa50E08 pKA1U5 AACTGTGTGGGGCTGGCGGCCGGCGGGAGAGGCGGCCGGCCTGGACTGGCCCGAGAGGGA
RBdS013K08 pGCAP10 GGTGTGGGGCTGGCGGCCGGCGGGAGAGGCGGCCGGCCTGGACTGGCCCGAGAGGGATCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl