Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04519

HP ID(1) HP04519
Gene ID(2) 5238
Gene Symbol finder PGM3
Protein Name phosphoglucomutase 3
RefSeq NM_015599.1
Length of RefSeq (bp) 2013
Chromosome 6q14.1-q15
Reference DDBJ accession
UniGene Hs.708038

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe12A09 pKA1U5 ATCCTGTGGGGTTTGGGTGCAGACGTTGTTGCTTGGGCGCTTCTCCGCTGCGTGTAGGTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl