Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04500

HP ID(1) HP04500
Gene ID(2) 10981
Gene Symbol finder RAB32
Protein Name RAB32, member RAS oncogene family
RefSeq NM_006834.3
Length of RefSeq (bp) 1234
Chromosome 6q24.3
Reference DDBJ accession
UniGene Hs.287714

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe04F05 pKA1U5 GGCGCCCGACAGCCGCAGCGCTCATGGCGGGCGGAGGAGCCGGGGACCCCGGCCTGGGGG
ARe37D05 pKA1U5 GAGAGCGCGAGGCCGGGCAGGGGGCCAGACTCGGAGTCGAGGCGCGCCCGACAGCCGCAG
ARe56B07 pKA1U5 GAGAGCGCGAGGCCGGGCAGGGGGCCAGACTCGCCATTATAGGCGCGCCCGACAGCCGCA
ARe66H06 pKA1U5 GAGACTCGGAGTCGAGGCGCGCCCGACAGCCGCAGCGCTCATGGCGGGCGGAGGAGCCGG
ARe97C07 pKA1U5 GGAGAGCGCGAGGCCGGGCAGGGGGCCAGACTCGGAGTCGAGGCGCGCCCGACAGCCGCA
ARe97F06 pKA1U5 GGCCCGACAGCCGCAGCGCTCATGGCGGGCGGAGGAGCCGGGGACCCCGGCCTGGGGGCG
ARi11F06 pGCAP10 GAGGCGGCGTCAGCGGGCGCGGCGGAGGGCTGGCCGGCCTCGGGGGAGTTTCCGCGGCCG
ARi17H09 pGCAP10 GGAGTTTCCGCGGCCGCCGGGGGCGCGGCGGCAGAGCGCGANGCCNGGCAGGGGGCCAGA
ARiS008O09 pGCAP10 GGGAGTCGAGGCGCNCCCGACAGCCGCAGCGCTCATGGCGGGCGGAGGAGCCGGGGACCC
ARiS122F15 pGCAP10 GAGTCGAGGCGCGCCCGACAGCCGCAGCGCTCATGGCGGGCGGAGGAGCCGGGGACCCCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl