Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04476

HP ID(1) HP04476
Gene ID(2) 64761
Gene Symbol finder PARP12
Protein Name poly (ADP-ribose) polymerase family, member 12
RefSeq NM_022750.2
Length of RefSeq (bp) 3805
Chromosome 7q34
Reference DDBJ accession
UniGene Hs.12646

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARa44G02 pKA1U5 GGCGGGCGGGCGGCGCAGCCGCGGCCCCGGAGCGCGTGGTGCTGGCCGCCTCGCCGCTGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl