Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04463

HP ID(1) HP04463
Gene ID(2) 5281
Gene Symbol finder PIGF
Protein Name phosphatidylinositol glycan anchor biosynthesis, class F
RefSeq NM_002643.3
Length of RefSeq (bp) 1057
Chromosome 2p21-p16
Reference DDBJ accession
UniGene Hs.468415

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARa43E09 pKA1U5 GGCCCGTCGTACCTGATGGTAGGAGGCAGTAGTTCCCCGCTTCCCTTCCGCGGGAGGGAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl