Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04413

HP ID(1) HP04413
Gene ID(2) 11133
Gene Symbol finder KPTN
Protein Name kaptin (actin binding protein)
RefSeq NM_007059.2
Length of RefSeq (bp) 1688
Chromosome 19q13.32
Reference DDBJ accession
UniGene Hs.25441

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb54A09 pGCAP1 TTTGAGCCCGCGCAACGGCCGGGCACCCGGCGGTTCAGGTCGCTTAGAGAGTCAGCAATG
RBd30E11 pGCAP10 GAGGTTGGGTAGTGCGGGTTGGGGCGGGGGCTGCGGAGAGGGTGCTTAACTGAGGGGCAT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl